triethanolamine (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher triethanolamine
Triethanolamine, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/triethanolamine+tea/TEA%2C+0%2E2M+buffer+soln%2E%2C+pH+8%2E0/bio_rxiv__64898__2026__02__26__708390-183-13-15
Average 94 stars, based on 1 article reviews

triethanolamine - by Bioz Stars, 2026-09

94/100 stars

Images

Saline:

Article Title: The Sublaterodorsal Tegmental Nucleus Functions to Couple Brain State and Motor Activity during REM Sleep and Wakefulness.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies 3,3-diaminobenzidine tetrahydrochloride with nickel Vector Laboratories SK-4100 4’,6-diamidino-2-phenylindole (DAPI) Cell Signaling 4083S Avidin-biotin-horseradish peroxidase (ABC Kit) Vector Laboratories Pk-8200 Biotinylated Goat Anti-Mouse IgG antibody Vector Laboratories BA-9200 Biotinylated Goat Anti-Rabbit IgG antibody Vector Laboratories BA-1000 C-Fos Rabbit Polyclonal Antibody Immunostar 26209 Cy3 goat, anti-mouse antibody Cedarlane CLCC35010 mCherry Mouse Polyclonal Antibody Signalway Antibody T513 Sheep anti-DIG-POD (Roche) Millipore Sigma 11207733910 TSA Plus Fluorescein System Perkin Elmer NEL741E001KT Vector NovaRedTM Peroxidase Substrate Kit Vector Laboratories SK-4800 Bacterial and Virus Strains rAAV8-hSyn-hM3Dq-mCherry UNC Vector Core; Dr. Bryan Roth N/A rAAV8-hsyn-hM4Di-mCherry UNC Vector Core; Dr. Bryan Roth N/A rAAV8-hSyn-eGFP UNC Vector Core; Dr. Bryan Roth N/A rAAV8-hSum-DIO-HM3D(Gq)-mCherry UNC Vector Core; Dr. Bryan Roth N/A rAAV8-hSyn-DIO-HM4D(Gi)-mCherry UNC Vector Core; Dr. Bryan Roth N/A rAAV8-hSyn-DIO-mCherry UNC Vector Core; Dr. Bryan Roth N/A Chemicals, Peptides, and Recombinant Proteins 2,2,2-Tribromoethanol (Avertin) Sigma Aldrich Cat #: T48402 CAS: 75809 2-methylbutane (isopentane) Fisher Scientific Cat #: 03551-4 CAS: 78784 50x Denhardt’s solution Fisher Scientific Cat #: BP520-5 Acetic anhydride Sigma Aldrich Cat #: 320102 CAS: 108247 Anafen Ketoprofen CDMV Inc Cat #:12868 CAS: 22071154 Antisense vGLUT2 riboprobe Gift from Dr. Patrick Fuller N/A Blocking reagent (Roche) Sigma Aldrich Cat #: 11096176001 Clozapine-n-oxide (CNO) Gift from Dr. Bryan Roth CAS: 34233697 Deionized formamide Sigma Cat #: F9037 CAS: 75127 Dextran sulfate Fisher Scientific Cat #: BP1585 CAS: 9011181 Diethylpyrocarbonate (DEPC) BioBasic Cat #: DB0154 CAS: 1609478 Dimethyl sulfoxide (DMSO) Sigma Aldrich Cat #: D2650 CAS: 67685 EDTA Fisher Scientific Cat #: BP2482 CAS: 60004 Ethanol (100%) Commercial Alcohols Cat #: P016EAAN CAS: 64175 Ethanol (95%) Commercial Alcohols P016EA95 CAS: 64175 Goat serum Fisher Scientific Cat #:16210064 (Continued on next page) e1 Current Biology 29, 1–11.e1–e5, November 18, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Hydrogen peroxide (H2O2) Sigma Cat #: 95321 CAS: 7722841 Isoflurane Fresenius Kabi Cat #: CP046V2 CAS: 26675467 Paraformaldehyde Bioshop Cat #: PAR070 CAS: 30525894 RNase Away Molecular Bioproducts Cat #: MB700711 Saline sodium citrate (SSC) 20X solution Bioshop Cat #: SSC795 Sodium chloride (NaCl) Sigma Cat #: S5886 CAS: 7647145 Triethanolamine (TEA) (Acros Organics) Fisher Scientific Cat #: 421630025 CAS: 102716 Tris-HCl Sigma Cat #: H1758 CAS: 7647010 Triton X-100 Sigma Cat #: T9284 CAS: 9002931 Trizma Base Sigma Cat #: T1503 CAS: 77-86-1 tRNA (Roche) Millipore Sigma Cat #: 10109541001 Experimental Models: Organisms/Strains Mouse: WT C57BL/6J Jackson Laboratories Jax: 000664 Mouse: orexin / B6.129S6-Hcrttm1Ywa/J Jackson Laboratories Jax: 08867 Mouse: vGLUT2-Cre B6.129S6(FVB)-Slc17a6tm2(cre)Lowl/MwarJ Jackson Laboratories Jax: 028863 Mouse: orexin / -vGLUT2-Cre This paper N/A Oligonucleotides Primer: orexin knockout forward CCGCTATCAGGACATAGCGTTGGC 25 nmol desalted Invitrogen 10336022 Primer: Wildtype orexin reverse GACGACGGCCTCAGACTTCTTGGG 25 nmol desalted Invitrogen 10336022 Primer: orexin common TCACCCCCTTGGGATAGCCCTTCC 25 nmol desalted Invitrogen 10336022 Software and Algorithms ImageJ ImageJ https://imagej.nih.gov/ij/ Prism GraphPad Version 5 Spike2 Cambridge Electronic Design Ltd. .. Version 7 Volocity Quorum Technologies Version 6.01 Other 3M Ketac-Cem, Applicap K-Dental 37125 Cable; ultra flexible micro miniature multi conductor Cooner Wire NMUF 8/30-4046SJ Chocolate Kiss Hershey’s N/A Microstrip connector Electrosonic CLP-105-02-L-D Multi-stranded stainless steel wire Cooner Wire AS 632 Parkell Inc C&B Metabond Cement System K-Dental 32997 Permafluor Fisher Scientific TA-030-FM Permount Fisher Scientific SP15 Stainless Steel Screw J.I.Morris P0090CE125 Tissue-Tek Cryomold 25x20x5mm Electron Microscopy Sciences 62534-25 Tissue-Tek OCT compound Electron Microscopy Sciences 62550-01 Current Biology 29, 1–11.e1–e5, November 18, 2019 e2

Knock-Out:

Software:

Microelectrode Array:

Article Title: Ecotoxicity risk assessment of amines used in 'switchable water' and CO 2 -capturing processes.
Article Snippet: .. The tested compounds are listed in Table 1: monoethanolamine (MEA) (Alfa Aesar, purity 98%), diethanolamine (DEA) (LachNer, purity 99%), triethanolamine (TEA) (Alfa Aesar, purity 98%), dimethylethanolamine (DMEA, reagent grade), 2-amino2-methyl-1-propanol (AMP, reagent grade), tetramethylethylenediamine (TMEDA) (Sigma Aldrich, purity 99%), tetramethyl1,3-propanediamine (TMPDA) (Sigma Aldrich, purity 99%). ..

Review